Bilan de la première semaine de stage

  • Par docjunior
  • Le 10/02/2016
  • Commentaires (1)

Hopital

Salut à tous !

Je fais ce billet pour vous résumer « rapidement » et sans étincelles ma première semaine de stage

 

Lundi
 

Lundi : J’étais impatient et curieux de savoir ce qui allait se passer. Arrivée à 8H30 et accueil de la part des responsables du service (1H après notre arrivée que l’on a passée à poireauter et prendre racine dans la salle de réunion de l’IBC. Vérification du terme stage plante verte). On nous explique les objectifs du stage, le programme puis on nous donne des articles scientifiques à présenter pour vendredi (à préparer hors stage bien sûr sinon ce n’est pas drôle). Puis s’en suit un cours sur comment présenter les articles et la visite express du service.


Il ne se passera alors plus rien de particulier jusqu’à 12H30 où l’on a fait pas grand-chose (rien en fait) hormis lire les articles. Puis à 12H30 on est parti en prenant soin de prévenir la secrétaire qui nous a répondu «  ah, euh c’est parfait vous pouvez y aller) en mode rien à foutre. Les prochaines fois on partira de nous-même sans la prévenir, ce n’est pas nécessaire. On est 6 en stage dans le service de biochimie maladie métabolique à l’IBC. Mais dans cet Institut de Biologie Clinique juxtaposé au CHU, il a y plusieurs services accueillant également d’autres P2 (pharmacologie, pharmacovigilance, hématologie, parasitologie etc…).

On a toujours pas mis nos blouses.

 

Mardi

 

Mardi : Je me réveille à 9H. Panique à bord, je suis sensé y être à 8H30. Je suis en retard et je stresse à mort. Je vais me faire en-gu-eu-ler par les chefs de services. Et je n’ai pas d’excuse hormis dire que mon réveil n’a pas sonné que je n’ai pas entendu mon réveil sonner. Plus je m’approche du bâtiment et plus je flippe. J’arrive à 9H15. Je me dirige vers la salle de réunion qui allait devenir notre seconde maison. Personne. Je stresse, que faire ? Je reste au moins 5 minutes à me demander si je reste là à attendre ou si je dois aller chercher dans les couloirs ou sont les autres. Après un gros débat interne, j’opte pour la seconde option et je prends mon courage à trois mains pour aller retrouver mes confrères camarades de P2. L’argument décisif est de me dire que si je reste là planté à ne rien faire on va encore plus me croire en retard.

Impossible de les trouver. Ils ne sont nulle part ! Je reviens à la salle et j’attends. Puis je reçois un sms. En fait ils sont à l’étage inférieur pour une petite présentation. J’enfile ma blouse (youpidou) et me hâte de les rejoindre. Finalement ça sera assez court, on remontera à la salle puis on appliquera à la lettre la méthode plante verte. Puis après en avoir eu trop marre, on décide d’aller se promener et on tombe sur un interne qui (par pitié ?) décide de s’occuper de nous. Il nous fait un rapide cours sur l’utilité des masters dans notre future carrière et sur notre plan de carrière.

A vrai dire il ne sait pas trop ce que l’on est sensé faire (super la communication entre la direction et les internes) et improvise de quoi nous occuper, un peu désolé à vrai dire. Il nous montre le logiciel avec les bilans des TP, les molécules, comment il marche etc.

En bas, pendant le pseudo cours, on a manqué une technicienne qui venait nous montrer des cultures cellulaires. Tant pis ça sera reporté (là aussi superbe communication j’ai envie de dire).

Enfin, réunion avec tous les professeurs, internes et externes pour assister à la présentation d’un cas clinique par une interne.

 

Mercredi 

 

Mercredi : Finalement j'arrive à 9H encore une fois car les internes nous on dit que ce n'était pas la peine de venir à 8H30. Il y a une nouvelle interne pour s’occuper de nous. Super sympa, souriante et jolie en plus d’après l’avis de mes Co-P2. Sauf que là aussi elle ne sait pas trop quoi nous faire faire. Alors on attend. Puis elle nous improvise un petit cours sur les principales protéines des bilans. Pour faire simple on a en gros pour le bilan général (il existe d'autres protéines encore) :

- Créatinine : corrélée à la masse musculaire et permet d’évaluer la fonction rénale       

- ACE (antigène carcino embryonnaire) : marqueur tumoral pour cancer du colon ou digestif

- Calcémie : métabolisme phosphocalcique qui peut marquer l’ostéoporose par exemple

- Kaliémie : dans plein de cas on peut avoir trop de potassium ou pas assez, ça peut signer un tas de choses

- Albumine (c’est la vie) : LA protéine du sang principale, marqueur de dénutrition

- Pré-albumine (trans-tyrétine) : pour voire si la renutrition chez les patients dénutris est efficace

- PSA : pour dépister le cancer de la prostate

- CRP (C réactive protéine) : marqueur de l’inflammation

- Alpha foetoro protéine : pour dépister le cancer du foie

- Trou anionique (ou je sais plus quoi) : je sais plus 

- B12 et B9 : les vitamines qui servent à la synthèse de l’ADN mais c’est très rare d’avoir des carences car les réserves sont énormes. Mais dans certains cas (ex grossesse) attention

Puis on va observer une technicienne faire des analyses sur du sang déposé sur un papier spécial séché. C’est une analyse qui ne se fait que très peu et il faut être spécialisé pour l’effectuer. Donc on va regrouper sur un endroit toutes les analyses qui y seront envoyées puis évaluées. Et en fait en France les laboratoires de biochimie se spécialisent dans certaines pathologies et on centralise les examens qui sont particulièrement rares (à cause d'un faible nombre de patients ou de l'utilisation d'une technique spéciale et rare).

Puis rebelotte présentation de cas cliniques par des externes.

On part vers 12H à présent.

Et pendant l’après-midi, j’ai soit cours (comme lundi ou mardi) soit je dois bosser. En effet le jeudi, j’ai aussi une présentation d’article pour mon master de biochimie. Mais l’article fait 10 pages (écrit sur 2 colonnes en tout petit) et est en anglais. Pas simple alors j’y passe de nombreuses heures pour le maitriser parfaitement. Et ça paye lors de la présentation le prof nous dira qu’on était proche du 20 malgré pas mal de détails sur la forme à régler (avec ma binôme). Et ça fait ultra plaisir car j’y ai passé des heures et des heures à le lire, le comprendre, le traduire et le maitriser ! Surtout que ça compte pour 10% de la note du master. Alors bien sûr, les articles pour le stage du vendredi non notés sont passés un peu en mode secondaire.

Et du coup ça m’a empêché de bosser les cours que l’on a eu depuis l’exam. Je n’ai encore rien fait ! Promis ce weekend je m’y mets !

 

Jeudi

 

Jeudi : Rien de notable hormis une amplification d’ADN par PCR (polymérase chain reaction) dont on nous a expliqué les étapes. Puis séquençage de gènes (NGS : new generation sequençage) de ce que l’on a obtenu. En fait le but est de récupérer un peu d’ADN de cellules puis de l’amplifier pour en avoir suffisamment ce qui nous permet de l’analyser et de voir s’il y a des mutations (comparaison via à un logiciel et des bases de données mais avant ça se faisait à l’œil nu ! Sachant que ce sont des pages et des pages de ATGCTACATTACCCTAACCTGGCTAGA etc… de bases d’ADN, imaginez le gain immense de temps !).

Notre super interne nous a aussi montré la maison des internes où on a pu y boire le café. Vous savez c’est là ou les internes peuvent y habiter, manger (dans la salle ou se trouve la fameuse presque), boire un coup. Sauf qu’il paraît que par rapport à d’autres internats, il n’y a pas d’ambiance ici.

En effet, ailleurs, il existe un panel de règles comme :

- l’interdiction de parler de médecine

- l’obligation de taper dans le dos de tout le monde avant de s’assoir à la première place vide (pour créer de la convivialité et du partage de sorte que les gens de différents services mangent entre eux et fassent connaissance),

- l'interdiction de sortir son téléphone sinon on est aspergé d’eau,

- pas le droit non plus d’utiliser des mots anglisés (ex ketchup se dit « la sauce rouge américaine ») 

- Et bien d'autres (celles-ci sont les plus courantes)

Si on contrevient à une de ces règles (excepté le téléphone), on fait tourner la roue qui correspond à des défis « médecine » bien salaces ! Sauf que ce n’est pas le cas ici où apparemment cette dernière n’est presque jamais tournée et il n’y a que très peu de règles. Pas vraiment d’ambiance donc.

A cette maison des internes s’organise aussi des soirées d’internats. Enfin je vous laisse imaginer la décoration très explicitement sexuelle. Les tapisseries, les tableaux, on ne peut pas poser son regard sans tomber sur de magnifiques images représentant de magnifiques parties de l'anatomie humaine et des actes d'une grande beauté.

Et d’ailleurs en allant à cette fameuse bâtisse (à 30s de l’IBC) on a croisé la chef du service qui nous a lancé un regard mi surpris mi interloqué devant la file indienne de blouses suivant l’interne hors de l’IBC. Petit moment d’anthologie. Mais bon on avait le droit, on suivait l'interne…

Et bien sûr jeudi soir, c’est soirée chez une amie. Mais je partirai avant minuit (un peu la flemme et de fatigue). Cette fois ci je n’ai pas trop bu histoire de ne pas terminer dans l’état peu glorieux de la soirée post exam ^^.

 

Vendredi

 

Vendredi on a pu voir des cultures cellulaires et on a fait la présentation des articles devant les externes et les internes. Présentation que j’avais moyennement bossée mais qui s’est passée crème.

Et pour une fois on a pu partir à 11H30 et pas midi. Sur le retour on a voulu aller se prendre un café à la maison des internes mais on n’a pas osé au final quand on a vu qu’il y avait du monde dedans pour rebrousser chemin.

Direction la Kfet (autrement dit, ma résidence secondaire) comme toutes les fois après le stage pour y retrouver nos amis et casser la croute, jouer aux cartes, au baby-foot ou tout simplement discuter (un de ces 4 je ferai un billet sur ce lieu mythique dans lequel on passe tant de temps).

Et l’après-midi, j’ai participé au tournage d’un petit film humoristique pour la campagne de don du sang sur le modèle de ******** (surprise pour les P2/P1 qui me lisent). D’ailleurs en ce moment j’ai pas mal de projets dans les cartons dont celui d’ouvrir une chaîne YouTube (qui n’a que trois vidéos pour l’instant). Sauf que c’est du boulot car il faut trouver les sujets des vidéos, se renseigner pour ensuite synthétiser le tout et y ajouter ses propres conseils et enfin expliquer tout cela à sa sauce.

 

Bilan de la première semaine : de moyen à pas mal

 

Pour faire un bilan, je dirai que ce stage me semble intéressant, qu'on y apprend certaines choses tout de même car les internes ont vraiment à coeur de bien s'occuper de nous (et les stages sont vraiment très internes dépendant en P2-D1) malgré la mauvaise organisation. Et même si je ne suis pas fan de lire puis présenter des articles c'est un bon entrainement pour ce qui va nous arriver par la suite (les internes qui ont leur thèse à faire par exemple devant se baser sur de nombreux articles mais même avant cette méthodologie pourra être utile). 

Mais tout de même on aura pas fait grand chose au final, on a pas mal rien foutu dans cette salle de réunion et qu'on s'est même demandé si on allait pas s'occuper via des jeux de société le premier jour. Il n'y a pas non plus tant eu de manip et de choses à faire jusqu'à présent. C'est sûr que par rapport à mon stage infirmier aux urgences où il y a sans cesse du travail, ça change énormement !

Après je ne suis pas mécontent du stage, c'est intéressant de voir un peu comment ça se passe, le travail derrière un examen  que l'on a demandé. Mais très clairement, je n'y passerai pas ma vie. Ce stage suffit. Et a vrai dire, selon les récits des P2, il y en a d'autres plus intéressant (et d'autres pas forcément mieux que le mien). La semaine prochaine je passe dans une autre section du service, et on sera divisé en 2 groupes de 3. J'espère qu'on fera plus de choses car à part 2-3 manip, c'était pas la folie du siècle.

J'espère par exemple être capable de valider les bilans, et bien comprendre ce qu'il y a dessus d'ici la fin du stage. Beaucoup d'autres P2 seraient dégoutés du stages mais j'essaye vraiment de retenir le positif, et il y en a. Voyons voir ce que donnera la semaine prochaine en tout cas !

On se dit à lundi matin (voire peut être même dimanche soir) pour un billet qui me tiens vraiment à cœur et que j’ai beaucoup travaillé et retravaillé. Il m’a demandé pas mal de temps et surtout de la réflexion alors n’hésitez pas à laisser votre avis ou votre impression par rapport à celui-ci dans les commentaires !

stage études

Aucune note. Soyez le premier à attribuer une note !

Commentaires (1)

Merlin
C'est vrai qu'en général les stages en labo ne sont pas palpitants... j'en ai fait les frais ^^
Mais si on essaye de s'impliquer un minimum, on peut retenir quelques trucs sympa. Ça peut être utile de voir des techniques de biologie en réalité, elles paraissent tellement flou dans les cours (PCR, FISH, etc).

Ajouter un commentaire

×